Homologous/ Analogous

      For this post I will be analyzing a particular homologous trait that both birds and dolphins share. If you look at a bird you will notice that it has a flipper, and on the other hand you will notice that a bird has it's wings. The dolphins flipper and the birds wings are actually homologous traits that they share with a common ancestor. The dolphin uses its flippers to swim while the bird uses its wings for flight. The reason the homologous trait exhibits so much difference between the two species is because they do share a common ancestor, but that common ancestor is very distant.
            
     For the analogous example I would like to take a look at fish and penguins. Fish breathe and live under water while penguins also go in the water but primarily live on land. The analogous trait that they both posses is their fins. They do have similar structure as they are both located on the sides of the animals. The reason both species possess this trait is because it was the best feature that was functional in each environment, not because the trait came from a common ancestor. However, it is true that all species do share a common ancestor. If we go back far enough I do believe that the common ancestor we find for these two species will also possess the analogous trait of having fins. The reason we know that these traits are analogous is became the two species do not possess the same trait as a result of common descent.

   

Protein Synthesis

DNA molecule:

GCCGTACCAAGGGAACGTCACACAAGGCAAGTTGATCATTG