Piltdown Hoax

1) The Piltdown Hoax was a scheme that started in 1912 when fossil remains said to be part of an early human were found in Piltdown, England. In 1953 however, the fossil remains were found to be a forgery and that they consisted of parts of an orangutan and a modern human. The men whom most likely cultivated the scheme are known as Charles Dawson and possibly Arthur Keith. Dawson has been the leading suspect for quite some time because coincidentally the fossil findings stopped as soon as he died. Keith has also been a prime suspect because he seemed to be the one who had the biggest motive. If the fossil had not been a forgery, scientists believed it could have been the answer to the relationship between apes and humans. The scientific community was mostly astonished at the find, however, there were a few skeptical scientists. The way scientists proved it was a forgery was because it actually was discovered to consist of three different species.

2) It was reported that jealousy may have been a factor in the decision to cultivate the Piltdown Hoax. Some scientists could possibly have been jealous that no human remains had been found in England so far. Whatever the motive was for whomever created the hoax, the person responsible was selfish, dishonest and irresponsible. This had a huge impact in the community because scientists for the most part always been well respected individuals. Now, with the hoax it opened up the door to the possibility that scientists could not be presenting truthful information.

3) A positive outcome of proving that the skull was a forgery was that now we don't take in information without questioning it. I believe that there was a time where a scientists word was good enough because the were so well respected. By questioning data we can now prove the authenticity of aspects of science such as fossil remains.

4) I believe that many things now can be analyzed by computers or robots instead of humans, which in turn provides us with more accurate analysis. However, I don't believe that taking out the human factor entirely would be a good idea nor would it work. Archaeologists make a living off finding information from the past and for the most part they are are pretty good at what they do. I also don't believe that a non-human factor could always be entirely accurate.

5) The biggest lesson that can be learned is that we can't always just accept something as being truthful just because somebody told us it was. Questioning and thorough analysis is vital to prove the authenticity of whatever piece of data an individual is presented with.

Locomotion Patterns

Lemurs: 

a) Lemurs take habitat exclusively on the island of Madagascar and the nearby Comoro Islands. Specifically, the Lemur lives within the rainforest among the many trees. Lemurs typically live in the rainforest canopy which is at the tops of the trees. However, there are exceptions to this fact and one of them is that the Ring-Tailed Lemur lives on ground level instead of within the canopy. As is true with most rainforests, the Lemurs habitat experiences heavy rainfall. The canopy, through photosynthesis, is the rain forests main source of energy.

b) A Lemurs main locomotion pattern is jumping. Lemurs are excellent jumpers because it is necessary that they move within the tree tops that make up the canopy. Lemurs are able to use their long back to push off from tree to tree. When distances are too great for jumping from tree to tree and descending to the forest floor is necessary, Lemurs walk upright and hop from side to side. This motion is most likely due to the fact that it helps with balance.

c) The rain forest played an important role in the influence of these locomotion patterns. Due to the fact that the forest floor contains the least amount of sunlight and consequently food such as fruits and vegetables, it was necessary that the Lemurs adapt and make their home where the resources are more plentiful. Since the resources that Lemurs require are at the top of the tress this means that the Lemurs also had to adapt and be able to move around the canopy and this is why they incorporated their jumping skills into their natural locomotion patterns.

d) 

**Crazy eyes**

Spider Monkey

a) Spider monkeys are found in the rain forests of Central and South America. Much like the Lemurs, spider monkey also live within the canopy of the rain forest. Because they live in the rain forest, Spider Monkeys also face much rainfall. There habitat is home to many different types of fruits and vegetables from which Spider Monkeys eat. The many insects that exist in the rainforest are also part of their diet.

b) The spider monkeys main locomotion pattern is also jumping. Since they live in the canopy, walking is not an option for them, therefore, they must travel from tree-to-tree by jumping and clinging. This is also how they avoid being hunted by predators. It should also be noted that, because of their size, humans see them in high value and they consequently have become one of the main types of animals hunted in the rain forest.

c) Like with the Lemurs, Spider Monkeys also rely upon this locomotion pattern due to the lack of resources they require toward the forest floor. Most of the food and nutrients that Spider Monkeys need to survive are located toward the tops of the rainforest. They also needed a way to move within the trees so they adopted the jumping pattern out of necessity. 

d) 

**Looking so wise**

Baboons

a) Baboons are commonly found in Africa and Arabia. They are ground dwelling and are found in the open savannah, open woodland and hills mainly in Africa. Their habitat differs greatly from that of the Lemur and the Spider Monkey. Baboons' habitat consists of mostly grassland with many trees that are widely spread. Sunlight is able to reach all the way to the ground level which is the opposite of the rainforest habitat that was previously discussed. The majority of rainfall take place in one particular season instead of year-round. 

b) Baboons are quadrupedal which means they walk on all fours and they walk on the ground. This is apposed to what humans are which is bipedal. 

c) The fact that sunlight is able to cover most of the floor is why Baboons do not require the ability to jump to the extent that Lemurs and Spider Monkeys do. The nutrients and the food that Baboons consume is available to them on ground level thus being the reason why they don't generally need to travel up to the tops of the tress. Also, jumping would not be a good locomotion pattern to express because the trees are spread too widely for animals to be able to jump across them. 

d) 

**Rafiki!!**

Gibbon

a) Gibbons take up habitat in the tropical rainforests and subtropical rainforests of Bangladesh, India, China and Indonesia however, mainly in southeast Asia. Their climate gets very hot, very humid, and very wet. They live in the canopy of rainforest similar to the Lemur and the Spider Monkey. 

b) Gibbons primary locomotion pattern is brachiation. This means that they swing from branch to branch. They do this by using their 4 fingers as hooks from which to grasp onto each branch. They can also leap up to 8m as well as walk bipedally with their arms raised for balance. They are considered the fastest of all tree dwelling mammals that do not fly. 

c) Like Lemurs and Spider Monkeys, the nutrients that Gibbons need are located in the canopy. This is why they adopted their brachiation locomotion pattern. They need to be able to move freely from tree to tree because this is where the majority of their resources are.

d)

**Although this gibbon is said to be singing in this particular picture,  this creature still looks pretty terrifying to me**

Chimpanzee

a) Common Chimpanzee have many different habitats which include dry savannah, dry woodland, rainforest, swamp and montane forest. Dry woodland and dry savannah, as discussed before, consist of expansive grassland with widely spread trees that allow for sunlight to shine through to much of the floor. These are typically dry habitats. The rainforest, as discussed earlier, is a wet habitat with little sunlight reaching the forest floor, much rainfall throughout the year and most of its resources being located within the canopy. Montana forests typically are located in the mountains and can be very cold as the elevation increases. 

b) Chimpanzees exhibit several different locomotion patterns. None of these however could be considered more prevalent over another due to he fact that Chimps live in so many different types of habitat. However it is visible to see which pattern would be primary in regard to each particular habitat. For example, in the rainforest and montane forest, Chimps are primarily bipedal, express brachiation and have the ability to leap very well. In the Savannahs and the Woodlands, Chimps are primarily quadrupedal and walk on their back soles and their front knuckles. Keep in mind that while each habitat does bring out a primary locomotion pattern Chimps still have the ability to utilize all of their locomotion patterns in all habitat types. 

c) Since Chimps do live in many different habitat types, they do have to be extremely adaptable. This is why we see them express many different patterns of locomotion. Nature simply made it so that Chimps need to have all these features to survive within each habitat. The reason they are bipedal and quadrupedal is so to make it easier to gain access to resources and nutrients necessary for survival. The reason they have the ability to brachiate and leap is also to allow for access to resources and nutrients in a particular habitat. 

d) 

**Now this guy(or girl) just looks like they are smirking at a funny joke one of its Chimp friends just told**

In summary, it is important to realize that habitat plays a huge role in how certain species have come to adopt their expressed locomotion patterns. Tree dwelling creatures that live in the rainforest are usually bipedal and arboreal. Also many tree dwelling creatures express brachiation which is the process of swinging from branch to branch. Tree dwelling creatures live within the trees for a reason and that reason is that their resources are located within the canopy so movement through the trees is necessary. Ground dwelling creatures have their necessary resources located on the ground floor and that is why they tend to express quadrupedalism. No matter what habitat is being looked at, the creatures that inhabit them express locomotion patterns that are specifically designed to aid them with their access to their required resources and nutrients. 

Homologous/ Analogous

      For this post I will be analyzing a particular homologous trait that both birds and dolphins share. If you look at a bird you will notice that it has a flipper, and on the other hand you will notice that a bird has it's wings. The dolphins flipper and the birds wings are actually homologous traits that they share with a common ancestor. The dolphin uses its flippers to swim while the bird uses its wings for flight. The reason the homologous trait exhibits so much difference between the two species is because they do share a common ancestor, but that common ancestor is very distant.
            
     For the analogous example I would like to take a look at fish and penguins. Fish breathe and live under water while penguins also go in the water but primarily live on land. The analogous trait that they both posses is their fins. They do have similar structure as they are both located on the sides of the animals. The reason both species possess this trait is because it was the best feature that was functional in each environment, not because the trait came from a common ancestor. However, it is true that all species do share a common ancestor. If we go back far enough I do believe that the common ancestor we find for these two species will also possess the analogous trait of having fins. The reason we know that these traits are analogous is became the two species do not possess the same trait as a result of common descent.

   

Protein Synthesis

DNA molecule:

GCCGTACCAAGGGAACGTCACACAAGGCAAGTTGATCATTG